Detail of EST/Unigene GE351210 |
Acc. | GE351210 |
Internal Acc. | MEUAY86TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC1 OS=Caenorhabditis elegans E-value=3e-19; DNA-directed RNA polymerases I, II, and III subunit RPABC1 OS=Caenorhabditis briggsae E-value=5e-19; DNA-directed RNA polymerases I, II, and III subunit RPABC1 OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=3e-18; DNA-directed RNA polymerases I, II, and III subunit RPABC1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=4e-17; DNA-directed RNA polymerases I, II, and III subunit rpabc1 OS=Dictyostelium discoideum E-value=5e-17; |
Length | 719 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GTGCAGTAACACTAGTTCTTTTCTTGAGGAAAGACATGTTTGTACACAGATTTTTTAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03013 DNA-directed RNA polymerase II subunit E |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824875 |
Trichome-related Gene from Literature | N/A |