| Detail of EST/Unigene GE351254 |
| Acc. | GE351254 |
| Internal Acc. | MEUAZ49TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Single-stranded DNA-binding protein, mitochondrial OS=Arabidopsis thaliana E-value=7e-54; Single-stranded DNA-binding protein OS=Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp) E-value=2e-08; Single-stranded DNA-binding protein OS=Rickettsia bellii (strain RML369-C) E-value=7e-08; Single-stranded DNA-binding protein OS=Wigglesworthia glossinidia brevipalpis E-value=2e-07; Single-stranded DNA-binding protein OS=Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB 8253 / DSM 158) E-value=3e-07; |
| Length | 618 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGACACCAAAAATGTGTTCGTGTACACCTCTCCTATACAAGAAAATTAATACAGGAGACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K03111 single-strand DNA-binding protein |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826707 |
| Trichome-related Gene from Literature | N/A |