| Detail of EST/Unigene GE351327 |
| Acc. | GE351327 |
| Internal Acc. | MEUB048TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=6e-96; Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=5e-95; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-91; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=7e-91; Ferredoxin--NADP reductase, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-90; |
| Length | 725 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GATAAACTCGGTTTCATCTATATTGCATGATCCTCAAAATTATTTCTTGCAACGGTTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.16.1.8 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836751 |
| Trichome-related Gene from Literature | N/A |