| Detail of EST/Unigene GE351346 |
| Acc. | GE351346 |
| Internal Acc. | MEUB074TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Medicago sativa E-value=0; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=1e-94; Caffeoyl-CoA O-methyltransferase OS=Vitis vinifera E-value=2e-93; Caffeoyl-CoA O-methyltransferase 5 OS=Nicotiana tabacum E-value=5e-93; Caffeoyl-CoA O-methyltransferase OS=Populus tremuloides E-value=1e-92; |
| Length | 746 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | CGAAAATAAAAGTCGATTTATATATATAACTTTCAATTATTCGAAGTTTCAATATCAATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
| EC | 2.1.1.104 2.1.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829551 |
| Trichome-related Gene from Literature | N/A |