| Detail of EST/Unigene GE351610 |
| Acc. | GE351610 |
| Internal Acc. | MEUB429TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=2e-49; Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=1e-46; Elongation factor Ts, mitochondrial OS=Zea mays E-value=2e-40; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-39; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-39; |
| Length | 721 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | AAGAAAATAATCAAATATTTAACCAGAGCCCACTAGTACACACTAACAGAAACCATTGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826713 |
| Trichome-related Gene from Literature | N/A |