Detail of EST/Unigene GE351610 |
Acc. | GE351610 |
Internal Acc. | MEUB429TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=2e-49; Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=1e-46; Elongation factor Ts, mitochondrial OS=Zea mays E-value=2e-40; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-39; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-39; |
Length | 721 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AAGAAAATAATCAAATATTTAACCAGAGCCCACTAGTACACACTAACAGAAACCATTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826713 |
Trichome-related Gene from Literature | N/A |