| Detail of EST/Unigene GE351638 |
| Acc. | GE351638 |
| Internal Acc. | MEUB466TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=5e-59; Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-50; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=4e-49; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-48; Dihydrodipicolinate synthase 1, chloroplastic OS=Triticum aestivum E-value=5e-46; |
| Length | 614 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGTAGTCGAGTTTATTTAATCAAGCGCTACAACATACATAATCTTGTCTTTTAAGTTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819152 |
| Trichome-related Gene from Literature | N/A |