Detail of EST/Unigene GE351638 |
Acc. | GE351638 |
Internal Acc. | MEUB466TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=5e-59; Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-50; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=4e-49; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-48; Dihydrodipicolinate synthase 1, chloroplastic OS=Triticum aestivum E-value=5e-46; |
Length | 614 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGTAGTCGAGTTTATTTAATCAAGCGCTACAACATACATAATCTTGTCTTTTAAGTTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |