Detail of EST/Unigene GE351728 |
Acc. | GE351728 |
Internal Acc. | MEUB588TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized oxidoreductase At1g06690, chloroplastic OS=Arabidopsis thaliana E-value=2e-99; Uncharacterized oxidoreductase Mb2320 OS=Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) E-value=2e-21; Uncharacterized oxidoreductase Rv2298/MT2355 OS=Mycobacterium tuberculosis E-value=2e-21; Aldo-keto reductase yakc [NADP(+)] OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-19; Pyridoxal reductase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=9e-16; |
Length | 809 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AGACCTTGTAGATAAGCACTTTATAGTAACTATAATAAGATATGAGATATCATTTGCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | 8.A.5 Voltage-gated K+ channel b-subunit VICb |
Probeset |
|
Corresponding NCBI Gene | 837179 |
Trichome-related Gene from Literature | N/A |