| Detail of EST/Unigene GE351741 |
| Acc. | GE351741 |
| Internal Acc. | MEUB610TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase OS=Helianthus annuus E-value=2e-47; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=1e-46; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=1e-46; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=1e-45; Probable phospholipid hydroperoxide glutathione peroxidase OS=Gossypium hirsutum E-value=2e-45; |
| Length | 441 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | AAATTAACTAGGGATAAATAGCACAAGCTTAGTTAAGCTCCCTGTCCTATGAAAGCGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.7 1.11.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818936 |
| Trichome-related Gene from Literature | N/A |