Detail of EST/Unigene GE351818 |
Acc. | GE351818 |
Internal Acc. | MEUB708TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dolichol phosphate-mannose biosynthesis regulatory protein OS=Mus musculus E-value=4e-20; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Rattus norvegicus E-value=9e-20; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Cricetulus griseus E-value=3e-19; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Homo sapiens E-value=1e-18; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Bos taurus E-value=2e-17; |
Length | 559 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAACCAAATCCATGTTGCATGTTAGATAGTAGATACATTAAGGACAAAAAATCTCCCTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2]; Metabolism > Glycan Biosynthesis and Metabolism > ko00563 Glycosylphosphatidylinositol(GPI)-anchor biosynthesis > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2]; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2] |
EC | 2.4.1.83 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843775 |
Trichome-related Gene from Literature | N/A |