Detail of EST/Unigene GE351892 |
Acc. | GE351892 |
Internal Acc. | MEUB801TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-27; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=1e-26; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-26; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=7e-26; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=4e-24; |
Length | 471 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GTAGTTTAAATTTCAATCAATTTAACATTTTTGTCAATTAAGATAGGACTTATACACATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |