| Detail of EST/Unigene GE351982 |
| Acc. | GE351982 |
| Internal Acc. | MEUB915TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 82A4 OS=Glycine max E-value=7e-64; Cytochrome P450 82A3 OS=Glycine max E-value=9e-62; Cytochrome P450 82A1 (Fragment) OS=Pisum sativum E-value=4e-60; Cytochrome P450 82A2 OS=Glycine max E-value=7e-57; Cytochrome P450 82C2 OS=Arabidopsis thaliana E-value=7e-43; |
| Length | 628 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | CCCTAAATTTTGATATACTCATTCAACACATCATTTTCTCTATATCTTTTTTCTATCATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00981 Insect hormone biosynthesis > K10720 CYP306A1; ecdysteroid 25-hydroxylase |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829327 |
| Trichome-related Gene from Literature | N/A |