| Detail of EST/Unigene GE352058 |
| Acc. | GE352058 |
| Internal Acc. | MEUBA12TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 2 OS=Arabidopsis thaliana E-value=4e-86; Mannan endo-1,4-beta-mannosidase 5 OS=Arabidopsis thaliana E-value=3e-84; Mannan endo-1,4-beta-mannosidase 2 OS=Oryza sativa subsp. japonica E-value=3e-65; Mannan endo-1,4-beta-mannosidase 6 OS=Oryza sativa subsp. japonica E-value=6e-56; Mannan endo-1,4-beta-mannosidase 7 OS=Arabidopsis thaliana E-value=1e-54; |
| Length | 719 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GCTAACAAAGTGCTTTGAAATTTACATCCTGTTGATTAATCCATCCCTTCGTTTTGCCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816596 |
| Trichome-related Gene from Literature | N/A |