Detail of EST/Unigene GE352060 |
Acc. | GE352060 |
Internal Acc. | MEUBA14TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon luteolum (strain DSM 273) E-value=1e-64; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) E-value=2e-64; GMP synthase [glutamine-hydrolyzing] OS=Chlorobium tepidum (strain ATCC 49652 / DSM 12025 / TLS) E-value=3e-64; GMP synthase [glutamine-hydrolyzing] OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) E-value=1e-63; GMP synthase [glutamine-hydrolyzing] OS=Chlorobium limicola (strain DSM 245 / NBRC 103803) E-value=1e-63; |
Length | 870 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | TTTTTTTTTGTAAAGTTATCTTTCGATCATTGAGGAGCAATTATAGTTCGATTCAATTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
EC | 6.3.5.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842670 |
Trichome-related Gene from Literature | N/A |