Detail of EST/Unigene GE352150 |
Acc. | GE352150 |
Internal Acc. | MEUBB35TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L24, chloroplastic OS=Pisum sativum E-value=2e-71; 50S ribosomal protein L24, chloroplastic OS=Arabidopsis thaliana E-value=1e-62; 50S ribosomal protein L24, chloroplastic OS=Nicotiana tabacum E-value=5e-61; 50S ribosomal protein L24, chloroplastic OS=Spinacia oleracea E-value=2e-52; 50S ribosomal protein L24 OS=Synechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) E-value=2e-33; |
Length | 611 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAGATCAACATAGGTACCAGAATAATAACACAACATAATATACACTTAACAATAAAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835549 |
Trichome-related Gene from Literature | N/A |