Detail of EST/Unigene GE352270 |
Acc. | GE352270 |
Internal Acc. | MEUBC86TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cyclin-D3-2 OS=Arabidopsis thaliana E-value=1e-52; Cyclin-D3-3 OS=Arabidopsis thaliana E-value=1e-50; Cyclin-D3-1 OS=Arabidopsis thaliana E-value=4e-50; Cyclin-D2-1 OS=Arabidopsis thaliana E-value=6e-28; Cyclin-D4-1 OS=Oryza sativa subsp. japonica E-value=2e-27; |
Length | 778 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CTGATCAAAAGACTAATAAATATTTTTCTTTCTTTTTTTGCATAATGAAAGGGGAATTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K10151 cyclin D2; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K10151 cyclin D2; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K10152 cyclin D3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K10152 cyclin D3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836861 |
Trichome-related Gene from Literature | N/A |