| Detail of EST/Unigene GE352322 |
| Acc. | GE352322 |
| Internal Acc. | MEUBD54TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=6e-50; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=5e-46; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=4e-42; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=2e-22; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=2e-14; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGAAAAAAGATTCATTTTCCATTGATCATATAGAAGCTTTTATCCAAATCAAATTGCAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842016 |
| Trichome-related Gene from Literature | N/A |