Detail of EST/Unigene GE352635 |
Acc. | GE352635 |
Internal Acc. | MEUBH49TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=3e-08; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=4e-08; 30S ribosomal protein S8, chloroplastic OS=Populus trichocarpa E-value=4e-08; 30S ribosomal protein S8, chloroplastic OS=Populus alba E-value=4e-08; 30S ribosomal protein S8, chloroplastic OS=Panax ginseng E-value=4e-08; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GTACATTTGGTACTTTCTTTTTAATAGAAAGCCCTTTTTTTGTTAAAATATTATCCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |