Detail of EST/Unigene GE352806 |
Acc. | GE352806 |
Internal Acc. | MEUBJ68TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=1e-24; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=1e-23; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=1e-23; Photosystem II 10 kDa polypeptide, chloroplastic OS=Spinacia oleracea E-value=1e-22; Photosystem II 10 kDa polypeptide, chloroplastic OS=Hordeum vulgare E-value=2e-21; |
Length | 428 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CATGGATTAACATGTTGATAAACATTTTGGTGAACCTATAGAGAGATGCATGGTTATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844245 |
Trichome-related Gene from Literature | N/A |