| Detail of EST/Unigene GH622981 |
| Acc. | GH622981 |
| Internal Acc. | PCF0509x184 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
| Length | 751 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_PAMP; |
| Sequence | AAAACACAATTCATTTCTTTTTATTTATTAAAATTAAACCATGGCTGCTTCTACAATGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |