Detail of EST/Unigene GO373281 |
Acc. | GO373281 |
Internal Acc. | ctsb4g8 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=9e-64; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-63; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-63; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=3e-63; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-63; |
Length | 1161 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_024456 (1 ESTs); |
Sequence | GAGCAGTCAGACTCTCTCCATCTGCGTGAGAAATTTCTGGAAATGGTTCGAGCTCGAATA |
EST members of Unigene | GO373281 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |