Detail of EST/Unigene GO374045 |
Acc. | GO374045 |
Internal Acc. | ctsc1n10 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=2e-18; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-17; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-17; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=5e-13; 30S ribosomal protein S14 OS=Nitrobacter hamburgensis (strain X14 / DSM 10229) E-value=8e-06; |
Length | 1076 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_024457 (1 ESTs); |
Sequence | CCAAACTCCAAAGCGGGAAATAAAGTACGGGCCTGCCCAAAAATCAAAATTCCCAAAACG |
EST members of Unigene | GO374045 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |