| Detail of EST/Unigene GO374045 |
| Acc. | GO374045 |
| Internal Acc. | ctsc1n10 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=2e-18; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-17; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-17; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=5e-13; 30S ribosomal protein S14 OS=Nitrobacter hamburgensis (strain X14 / DSM 10229) E-value=8e-06; |
| Length | 1076 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024457 (1 ESTs); |
| Sequence | CCAAACTCCAAAGCGGGAAATAAAGTACGGGCCTGCCCAAAAATCAAAATTCCCAAAACG |
| EST members of Unigene | GO374045 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818015 |
| Trichome-related Gene from Literature | 818015 |