| Detail of EST/Unigene GO600641 |
| Acc. | GO600641 |
| Internal Acc. | NBERO1CH_T3_006_A07_28APR2006_063 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=8e-94; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=2e-90; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=1e-89; Shaggy-related protein kinase alpha OS=Arabidopsis thaliana E-value=5e-83; Glycogen synthase kinase-3 homolog MsK-1 OS=Medicago sativa E-value=2e-82; |
| Length | 700 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542 (1 ESTs); |
| Sequence | TTTTTCTCTCTCTTCCCCCCCTCTCTCTCTCTAAACCTAACCGACAATAATGATGCTTGA |
| EST members of Unigene | GO600641 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
| EC | 2.7.11.26 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827605 |
| Trichome-related Gene from Literature | 827605 |