| Detail of EST/Unigene GO601686 |
| Acc. | GO601686 |
| Internal Acc. | NBERO1CH_T3_017_C02_01MAY2006_012 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=8e-99; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=2e-95; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=2e-89; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-51; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=1e-43; |
| Length | 775 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542 (1 ESTs); |
| Sequence | CTTTTCATACCCATTCTCTCCTTCTTCCATTTCTAGCTCCGCCCTCTCTCTTTCTCTCTG |
| EST members of Unigene | GO601686 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01968 3-methylcrotonyl-CoA carboxylase alpha subunit |
| EC | 6.4.1.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833497 |
| Trichome-related Gene from Literature | 833497 |