Detail of EST/Unigene GO603409 |
Acc. | GO603409 |
Internal Acc. | NBERO1CH_T3_037_A11_06JUL2006_095 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=6e-61; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=2e-60; Trans-cinnamate 4-monooxygenase OS=Medicago sativa E-value=5e-60; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=7e-60; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=9e-60; |
Length | 644 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024542 (1 ESTs); |
Sequence | ACATGGTCAAACTTCTTAGAAACACCATCTTTTGCATTCTATTTACAACCGCATTTCATT |
EST members of Unigene | GO603409 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |