Detail of EST/Unigene GO606038 |
Acc. | GO606038 |
Internal Acc. | NBERO1CH_T3_066_D02_03AUG2006_010 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=0; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=0; |
Length | 771 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024542 (1 ESTs); |
Sequence | GTAACAGGGGGAGAAGCTGACAATTATGGCCATGGCAACGGCTCTTCGAAGACTCTCCTC |
EST members of Unigene | GO606038 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |