| Detail of EST/Unigene GO607219 |
| Acc. | GO607219 |
| Internal Acc. | NBERO1CH_T3_082_D04_03AUG2006_026 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=7e-94; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=8e-92; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=4e-90; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=1e-89; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=9e-89; |
| Length | 555 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542 (1 ESTs); |
| Sequence | CCAAAAGATGGATCTTCTCCTTCTAGAGAAGACCCTTATAGGCTTATTCTTTGCTATCAT |
| EST members of Unigene | GO607219 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |