| Detail of EST/Unigene GO608785 |
| Acc. | GO608785 |
| Internal Acc. | NBLEL3_JP_003_A12_23JUN2004_096 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=1e-11; 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=5e-11; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=5e-11; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=5e-11; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=5e-11; |
| Length | 100 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024543 (1 ESTs); |
| Sequence | CAAATGCCAAACACATTGCCAACACCGGCCCAGCTTCCGTCATTCCATAACCCTGGCCAA |
| EST members of Unigene | GO608785 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841593 |
| Trichome-related Gene from Literature | 841593 |