Detail of EST/Unigene GO612183 |
Acc. | GO612183 |
Internal Acc. | NBREL4_JP_004_G02_13NOV2004_004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=2e-56; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=2e-54; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=3e-54; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=7e-54; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=2e-53; |
Length | 369 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024545; |
Sequence | GAAGGAAAATTTACAGACAATTATGGTGATTTTATCCCTATTTTGAGACCTTTTTTGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |