| Detail of EST/Unigene GO612235 |
| Acc. | GO612235 |
| Internal Acc. | NBREL4_JP_005_D02_13NOV2004_010 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=9e-52; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=7e-50; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=1e-49; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=3e-49; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=9e-49; |
| Length | 342 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024545; |
| Sequence | GATTTTATCCCTATTTTGAGACCTTTTTTGAGAGGTTACTTGAAGATCTGTAAGGAAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |