Detail of EST/Unigene GT160429 |
Acc. | GT160429 |
Internal Acc. | LA0716T6L3_01_M20_T7-ZL |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=7e-20; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=9e-20; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-18; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=1e-17; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=5e-16; |
Length | 407 nt |
Species | Solanum pennellii |
Belonged EST Libraries | LIBEST_025263; |
Sequence | GGGGAAGCTGTTGAAACTGCGAAGCAATTAGCCCTACAAGAAGGGTTGTTGGTTGGGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |