Detail of EST/Unigene GT167414 |
Acc. | GT167414 |
Internal Acc. | M82T7el_06_N22_T7-ZL |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Late embryogenesis abundant protein Lea5 OS=Citrus sinensis E-value=5e-08; Late embryogenesis abundant protein Lea5-D OS=Gossypium hirsutum E-value=1e-07; Late embryogenesis abundant protein Lea5-A OS=Gossypium hirsutum E-value=4e-07; |
Length | 126 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_025267; |
Sequence | TGATGGAATCAAACAAGACTTCATGGGTACCAGATCCTGTTACTGGTTATTACAGACCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828053 |
Trichome-related Gene from Literature | 828053 |