Detail of EST/Unigene GT167968 |
Acc. | GT167968 |
Internal Acc. | M82T7el_03_E20_T7-ZL |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=6e-19; Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=1e-18; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-17; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=1e-13; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=2e-06; |
Length | 213 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | LIBEST_025267; |
Sequence | TATTCAAGATAACAAACGCAGATTGTTGTCTGCTAAGTAAGAATTGAGGCGAAAGTTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |