| Detail of EST/Unigene GT173711 |
| Acc. | GT173711 |
| Internal Acc. | LH__Ea0015G08.f |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=0; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=4e-95; Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=1e-90; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=3e-79; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=3e-76; |
| Length | 1180 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | LIBEST_025268 (1 ESTs); |
| Sequence | CGTTGCATGATTGACGTTAATTATTAGAGTAATACATGAGTAAAATCTTATTAAATGACG |
| EST members of Unigene | GT173711 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.17 2.4.1.45 2.4.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827220 |
| Trichome-related Gene from Literature | 827220 |