Detail of EST/Unigene GW330560 |
Acc. | GW330560 |
Internal Acc. | AAGST_UP_005_A12_07MAY2004_096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Monoterpene synthase FDS-5, chloroplastic OS=Artemisia spiciformis E-value=1e-57; Chrysanthemyl diphosphate synthase, chloroplastic OS=Tanacetum cinerariifolium E-value=3e-56; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=2e-37; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=4e-37; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=7e-37; |
Length | 605 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025693; |
Sequence | GTATGTATTATCAAATTCAGAATGATTATCTCGATACTTTTGGTGATCCTAATGTTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |