Detail of EST/Unigene GW330778 |
Acc. | GW330778 |
Internal Acc. | AAGST_UP_007_H01_07MAY2004_001 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-15; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=3e-14; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-12; |
Length | 374 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025693; |
Sequence | GGCTGTAAAATTAATATATCAACTTATCCTTGTACTTACGTAAATATCAGGTGAGACTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |