| Detail of EST/Unigene GW330900 |
| Acc. | GW330900 |
| Internal Acc. | AAGST_UP_009_D05_07MAY2004_041 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Monoterpene synthase FDS-5, chloroplastic OS=Artemisia spiciformis E-value=1e-55; Chrysanthemyl diphosphate synthase, chloroplastic OS=Tanacetum cinerariifolium E-value=2e-54; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=1e-36; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=3e-36; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=5e-36; |
| Length | 453 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025693; |
| Sequence | CAAATTCAGAATGATTATCTCGACACTTTTGGTGATCCTAATGTTTTTGGCAAGACTGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |