| Detail of EST/Unigene GW331590 |
| Acc. | GW331590 |
| Internal Acc. | AAGST_UP_018_D07_26AUG2004_057 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase family 2 member C4 OS=Arabidopsis thaliana E-value=8e-22; Aldehyde dehydrogenase family 2 member B4, mitochondrial OS=Arabidopsis thaliana E-value=4e-17; Aldehyde dehydrogenase family 2 member B7, mitochondrial OS=Arabidopsis thaliana E-value=2e-15; Retinal dehydrogenase 1 OS=Mesocricetus auratus E-value=5e-15; Retinal dehydrogenase 1 OS=Gallus gallus E-value=7e-15; |
| Length | 284 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025693; |
| Sequence | GATTCGACCCTTGAATAAAAATTTCATAAAAAACAAAGATGAGCTCAGGAGCTAATGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
| EC | 1.2.1.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822042 |
| Trichome-related Gene from Literature | 822042 |