Detail of EST/Unigene GW333653 |
Acc. | GW333653 |
Internal Acc. | AAGST_UP_051_G01_31OCT2005_003 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Monoterpene synthase FDS-5, chloroplastic OS=Artemisia spiciformis E-value=1e-46; Chrysanthemyl diphosphate synthase, chloroplastic OS=Tanacetum cinerariifolium E-value=8e-46; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=2e-30; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=3e-30; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=6e-30; |
Length | 338 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025693; |
Sequence | GTTTTTGGCAAGACTGGAACAGATATTGAAGAATGCAAGTGCTCATGGTTGATTGCGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |