| Detail of EST/Unigene GW334218 |
| Acc. | GW334218 |
| Internal Acc. | GSTSUB_UP_009_C09_20AUG2004_075 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=7e-18; Glutathione S-transferase F3 OS=Arabidopsis thaliana E-value=3e-17; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=3e-17; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=4e-17; Glutathione S-transferase OS=Hyoscyamus muticus E-value=2e-16; |
| Length | 170 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | LIBEST_025694; |
| Sequence | GATTTCGTTATTGTCGATATGCCTAACAAAGAACACAAGAAGCCCGAATTCTTATCACGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827931 |
| Trichome-related Gene from Literature | 827931 |