Detail of EST/Unigene GW336767 |
Acc. | GW336767 |
Internal Acc. | GSTSUB_UP_058_D11_27OCT2005_089 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Monoterpene synthase FDS-5, chloroplastic OS=Artemisia spiciformis E-value=2e-31; Chrysanthemyl diphosphate synthase, chloroplastic OS=Tanacetum cinerariifolium E-value=1e-30; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=7e-19; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=2e-18; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=2e-18; |
Length | 543 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025694; |
Sequence | CGTTGATACTTCGTTATGTAGTTTATTAATTGTTATTTTGTTAAACGTTACAGTGACACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |