| Detail of EST/Unigene HO222115 |
| Acc. | HO222115 |
| Internal Acc. | NTSP_EST_0013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ranunculus acris E-value=7e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=9e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petroselinum crispum E-value=1e-14; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Mesembryanthemum crystallinum E-value=1e-14; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pisum sativum E-value=2e-14; |
| Length | 131 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_026545; |
| Sequence | TGGTCCATCCACGAAGGACTGGAGAGGTGGAAGAGCTGCTTCACTCAACGTCATTCCCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00134 glyceraldehyde 3-phosphate dehydrogenase |
| EC | 1.2.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819567 |
| Trichome-related Gene from Literature | 819567 |