Detail of EST/Unigene JK494787 |
Acc. | JK494787 |
Internal Acc. | CSATR1JP-T3-011_J01_3DEC2008_007 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-88; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-88; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=2e-88; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=2e-87; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=5e-87; |
Length | 791 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_027499 (1 ESTs); |
Sequence | ATAACCTTAAACACAAACACTCTCATCTCTTCTCCACTCTCTCTGTCTCTGTTTTTTTTT |
EST members of Unigene | JK494787 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |