| Detail of EST/Unigene MSU15591 |
| Acc. | MSU15591 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=0; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=0; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=0; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=0; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=0; |
| Length | 1372 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS (1 ESTs); |
| Sequence | GGCACGAGTAGAGATTCCTGTGTAGCTATTTGTCTATTACTTGCTTTTCACACACTGTGT |
| EST members of Unigene | MSU15591 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1733.1.S1_at, Mtr.1798.1.S1_s_at
|
| Corresponding NCBI Gene | 833738 |
| Trichome-related Gene from Literature | N/A |