Detail of EST/Unigene MSU15591 |
Acc. | MSU15591 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=0; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=0; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=0; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=0; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=0; |
Length | 1372 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | GGCACGAGTAGAGATTCCTGTGTAGCTATTTGTCTATTACTTGCTTTTCACACACTGTGT |
EST members of Unigene | MSU15591 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1733.1.S1_at, Mtr.1798.1.S1_s_at
|
Corresponding NCBI Gene | 833738 |
Trichome-related Gene from Literature | N/A |