Detail of EST/Unigene MSU20736 |
Acc. | MSU20736 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Medicago sativa E-value=0; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=0; Caffeoyl-CoA O-methyltransferase OS=Populus tremuloides E-value=0; Caffeoyl-CoA O-methyltransferase 1 OS=Populus trichocarpa E-value=0; Caffeoyl-CoA O-methyltransferase 2 OS=Populus trichocarpa E-value=0; |
Length | 966 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | CAGAAAAAGAAGCAAAACATTCCAAGAATTTAACAATGGCAACCAACGAAGATCAAAAGC |
EST members of Unigene | MSU20736 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
EC | 2.1.1.104 2.1.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1622.1.S1_at, Mtr.16956.1.S1_at
|
Corresponding NCBI Gene | 829551 |
Trichome-related Gene from Literature | N/A |