| Detail of EST/Unigene SRR027943.110679 |
| Acc. | SRR027943.110679 |
| Internal Acc. | E6L1MXO01AZSIX |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Adenylate isopentenyltransferase 7, mitochondrial OS=Arabidopsis thaliana E-value=7e-18; Adenylate isopentenyltransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; Adenylate isopentenyltransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Adenylate isopentenyltransferase OS=Humulus lupulus E-value=4e-16; Adenylate isopentenyltransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-16; |
| Length | 287 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGATAATTTTTTAATAGTAAAGTATATTTTTCACTAGTAATCTATAATTACTACTATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |