Detail of EST/Unigene SRR027943.119380 |
Acc. | SRR027943.119380 |
Internal Acc. | E6L1MXO01A914E |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-34; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-34; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-34; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-34; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-34; |
Length | 240 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCAAGCCCAGATGGCTAAGATGCTCTGTGCATGGACCAAGCTTGGGTTGCCCAAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |