Detail of EST/Unigene SRR027943.124748 |
Acc. | SRR027943.124748 |
Internal Acc. | E6L1MXO01DY3O8 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 134 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTAGAGACCGAGGCGGCCGACTGTTTTGTTTTTTTTCTTTTTTTTTCTTCAGTGGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |