Detail of EST/Unigene SRR027943.136766 |
Acc. | SRR027943.136766 |
Internal Acc. | E6L1MXO01EUURC |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=7e-31; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=9e-31; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=2e-28; Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=1e-20; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=3e-20; |
Length | 243 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCATGCACAAAGCATCTTGGCCATCTGGGCTTGCCATGTTGTGTTGATGGGAGCTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |