Detail of EST/Unigene SRR027943.140978 |
Acc. | SRR027943.140978 |
Internal Acc. | E6L1MXO01A952I |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-2,3-enoyl-CoA reductase OS=Dictyostelium discoideum E-value=2e-12; Trans-2,3-enoyl-CoA reductase OS=Rattus norvegicus E-value=2e-07; Trans-2,3-enoyl-CoA reductase OS=Mus musculus E-value=2e-07; Trans-2,3-enoyl-CoA reductase OS=Homo sapiens E-value=5e-07; Trans-2,3-enoyl-CoA reductase OS=Bos taurus E-value=5e-07; |
Length | 243 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTCGTCGAGGAAATGGTCTACAGGAAAGGAGGCAATATCACCCATCGTCGAGGATAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |