Detail of EST/Unigene SRR027943.141042 |
Acc. | SRR027943.141042 |
Internal Acc. | E6L1MXO01DD6M7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-18; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-16; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-15; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=4e-14; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=9e-14; |
Length | 266 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGTAGCTTGGGGACTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGGCCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |